Detail of Probeset Mtr.16478.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.16478.1.S1_at
Species Medicago truncatula
Annotation IMGAG|825.m00022 /FEA=mRNA /DEF=LQGC hypothetical protein AC130275.16.221 76987 76671 mth1-63a17 01/13/05
Mapped public sequence ID IMGAG|825.m00022
Gene Ontology GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0005739 GO:0008233 GO:0032197 GO:0005575 GO:0005634
KEGG K07497 K15001
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence atggcgacggatccgcactggaattgtgaaggattcggctgccacttgtatttgagaccc
aatgggacactgccacctggaattggaccttgctgcaaaaag