Detail of Probeset Mtr.16601.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.16601.1.S1_at
Species Medicago truncatula
Annotation IMGAG|831.m00012 /FEA=mRNA /DEF=Copper/Zinc superoxide dismutase AC130801.16.121 78670 77054 mth2-12p19 01/13/05
Mapped public sequence ID IMGAG|831.m00012
Gene Ontology GO:0000187 GO:0000303 GO:0001541 GO:0001819 GO:0001895 GO:0002262 GO:0004784 GO:0005507 GO:0005515 GO:0005615 GO:0005634 GO:0005737 GO:0005739 GO:0005829 GO:0005886 GO:0006302 GO:0006309 GO:0006749 GO:0006801 GO:0006879 GO:0006979 GO:0007283 GO:0007566 GO:0007568 GO:0007569 GO:0007605 GO:0007626 GO:0008217 GO:0008270 GO:0008340 GO:0009408 GO:0010033 GO:0016209 GO:0019226 GO:0019430 GO:0030346 GO:0031012 GO:0031410 GO:0032287 GO:0032839 GO:0040014 GO:0042493 GO:0042542 GO:0043025 GO:0043085 GO:0043234 GO:0043524 GO:0045471 GO:0045541 GO:0045859 GO:0046716 GO:0048678 GO:0050665 GO:0051087 GO:0051881 GO:0060047 GO:0060052 GO:0060087 GO:0060088
KEGG K04565
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database TCMS41027  TCMT49485  
Target sequence aaggctgtggcagttcttggtaacagtaatgatgtctctggtactattagcttcactcag
gagggaaatggtccaaccactgtgactggaaatctttctggtcttaagcctggcctccat
ggcttccatatccatgccttgggggacaccacgaatggttgcttgtcaaccggaccacat
ttcaatcctaatggtaaggagcacggtgcccctgaggatgagactcgacatgctggtgat
ttaggaaatgtcacc