Detail of Probeset Mtr.16634.1.S1_s_at in Chip AffyMedicago |
Probeset ID |
Mtr.16634.1.S1_s_at |
Species |
Medicago truncatula |
Annotation |
IMGAG|832.m00030 /FEA=mRNA /DEF=hypothetical protein AC130805.15.301 136321 136154 mth2-9n1 01/13/05 |
Mapped public sequence ID |
IMGAG|832.m00030 |
Gene Ontology |
GO:0000118 GO:0000792 GO:0003677 GO:0003682 GO:0003700 GO:0003714 GO:0004407 GO:0005515 GO:0005634 GO:0005737 GO:0007492 GO:0008134 GO:0016481 GO:0016568 GO:0016581 GO:0019899 GO:0042802 |
KEGG |
K06067 |
Transporter |
|
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
N/A |
Target sequence |
ggagattgaccctttctttgttagagaaaaggtcctggcaaagcagttgtctgttgtgca
tattcctggtacagatcagcgggctgacattcttactaaaccagtatctacagccaagtt
tcttcttatgcgctccaaactcaatgttgctgaagccccaccttga |