| Detail of Probeset Mtr.16685.1.S1_x_at in Chip AffyMedicago |
| Probeset ID |
Mtr.16685.1.S1_x_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|878.m00017 /FEA=mRNA /DEF=hypothetical protein AC135565.18.171 55460 55621 mth2-19b12 01/13/05 |
| Mapped public sequence ID |
IMGAG|878.m00017 |
| Gene Ontology |
GO:0003674 GO:0003697 GO:0003727 GO:0005515 GO:0005634 GO:0005737 GO:0005783 GO:0005829 GO:0007242 GO:0008284 GO:0045944 |
| KEGG |
K01741 K09250 K10773 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
ctcgcgagcaggagttgttcgcctcgcgagttgcatttcgcagctcgccatagcgagcaa
gtttactcgccgtggcgagtgtgggcagagagcttgcaagattctgtgtttttgagctgt
gagtttaaccttaggtgtttgtga |
