| Detail of Probeset Mtr.16726.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.16726.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|835.m00015 /FEA=mRNA /DEF=Leucine-rich repeat, cysteine-containing; Leucine-rich repeat, cysteine-containing subtype; Cyclin-like F-box AC130809.24.151 60642 63475 mth2-15i12 01/13/05 |
| Mapped public sequence ID |
IMGAG|835.m00015 |
| Gene Ontology |
GO:0000152 GO:0004842 GO:0005515 GO:0005737 GO:0006464 GO:0006508 GO:0006511 GO:0019005 |
| KEGG |
K10268 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT60582 |
| Target sequence |
tcttcgagggtgcaagaggctcactgataaatgcataacagttctatttgatgggtgtgg
caagttg |