| Detail of Probeset Mtr.16824.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.16824.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|839.m00014 /FEA=mRNA /DEF=Heavy metal transport/detoxification protein; E1-E2 ATPase-associated region; Haloacid dehalogenase-like hydrolase; ATPase, E1-E2 type; Copper ion-binding; Copper-translocating P-type ATPase; Heavy metal translocating P-typ |
| Mapped public sequence ID |
IMGAG|839.m00014 |
| Gene Ontology |
GO:0004008 GO:0005507 GO:0005515 GO:0005524 GO:0005770 GO:0005802 GO:0005887 GO:0006825 GO:0006878 GO:0015677 GO:0016020 GO:0016023 GO:0016323 GO:0046688 GO:0048471 GO:0051208 |
| KEGG |
K01533 |
| Transporter |
3.A.3 3.A.3.5.3 3.A.3.5.6 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
gggtgtcatacctgttatggttacaggagataactggcgaacagctcgtgctgttgcaaa
ggaggttggaatccaagatgtaagggcagaggtgatgcctgcgggaaaagccgaaattgt
tcgttcattccaaaaggacggaagcatagttgcaatggtgggcgatggcatcaacgattc
tccagcattagctgctgctgatgttggcatggcaattggggctggaactgatgttgcaat
agaagctgctaactt |
