| Detail of Probeset Mtr.16829.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.16829.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|839.m00016 /FEA=mRNA /DEF=SAM (and some other nucleotide) binding motif AC131248.14.151 75770 79687 mth2-28n22 01/13/05 |
| Mapped public sequence ID | IMGAG|839.m00016 |
| Gene Ontology | GO:0005515 GO:0005575 |
| KEGG | K01415 K15051 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | CO511742 TCMT47539 |
| Target sequence | gaaaaatctgttaatccactctgggagctgacaaaacctattccacttaataatgatgga |