| Detail of Probeset Mtr.16843.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.16843.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|885.m00019 /FEA=mRNA /DEF=hypothetical protein AC135959.22.191 64603 64121 mth2-26j19 01/13/05 |
| Mapped public sequence ID |
IMGAG|885.m00019 |
| Gene Ontology |
GO:0006120 GO:0008137 GO:0016655 |
| KEGG |
K05579 |
| Transporter |
3.D.1 3.D.1.1.1 3.D.1.3.1 3.D.1.2.1 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
gttggaattaagtcgcatagcttctcatctactatggctgggaccttttatggcagatat
tggtgcacaaaccccctttttctatatttttagagaaagagaattaatatatgatctatt
tgaagttacgtcagttatgagaatgatgcataattattttcgtattgga |
