| Detail of Probeset Mtr.16863.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.16863.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|886.m00021 /FEA=mRNA /DEF=Histone-fold; Histone core; Transcription factor CBF/NF-Y/archaeal histone; Histone-fold/TFIID-TAF/NF-Y AC136138.30.201 99296 98943 mth2-8f9 01/13/05 |
| Mapped public sequence ID |
IMGAG|886.m00021 |
| Gene Ontology |
GO:0003677 GO:0003700 GO:0003704 GO:0005634 GO:0006109 GO:0006350 GO:0006355 GO:0016563 GO:0016602 GO:0030447 GO:0030448 GO:0030528 GO:0033217 |
| KEGG |
K08066 |
| Transporter |
|
| Transcription Factor |
CCAAT-HAP5 |
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
gattctagtactgatgccaccactctcatgcaaatggaaagt |