| Detail of Probeset Mtr.16944.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.16944.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|890.m00016 /FEA=mRNA /DEF=RNA-binding region RNP-1 (RNA recognition motif); Polyadenylate-binding protein/Hyperplastic disc protein; Polyadenylate binding protein, human types 1, 2, 3, 4; RNA recognition, region 1; Paraneoplastic encephalomyelitis |
| Mapped public sequence ID |
IMGAG|890.m00016 |
| Gene Ontology |
GO:0003729 GO:0005829 GO:0008022 GO:0008143 GO:0005737 GO:0031370 GO:0043009 GO:0043621 GO:0048255 GO:0060212 |
| KEGG |
K10593 K19472 K19652 K25647 |
| Transporter |
|
| Transcription Factor |
C2H2 C3H |
| Mapped unigene in the TRICHOME database |
TCMS40645 TCMT40746
|
| Target sequence |
tatgccacaacagatgctccctaggggacgtgtatatcgctatcctcctggaaggggcat
gcctgatggtcccatgcctggagttgctggaggcatgtattctgttccttatgacgtggg
tgggatgcccattcgcgatgcatcactttcccagcaaattcctattggtgctttggcttc
tcatctggctaatgcatctcccgagcagcagagaacgatgctgggtgagaatctttaccc
acttgtggaacaatt |
