| Detail of Probeset Mtr.17030.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.17030.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|893.m00025 /FEA=mRNA /DEF=LQGC hypothetical protein AC136506.10.251 106336 106142 mth2-33c8 01/13/05 |
| Mapped public sequence ID | IMGAG|893.m00025 |
| Gene Ontology | GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0005739 GO:0008233 GO:0032197 GO:0004565 GO:0005990 GO:0008811 GO:0046677 GO:0004356 GO:0005737 GO:0006417 GO:0006538 GO:0006542 GO:0006807 GO:0007416 GO:0009117 GO:0043094 GO:0045213 GO:0005575 GO:0002119 GO:0009792 GO:0015277 GO:0040007 GO:0000794 GO:0003674 GO:0003697 GO:0005634 GO:0005856 GO:0008017 GO:0008150 GO:0047497 GO:0048471 GO:0048487 GO:0051015 |
| KEGG | K00140 K00638 K01915 K05387 K13663 K15001 K17671 K17699 K18599 K22300 |
| Transporter | 1.A.10 1.A.10.1.1 1.A.10.1.2 |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | BF648696 |
| Target sequence | gtgtcacgatgccaaattcgtgtcacgatttctctgttcttccagaccacaaatt |