Detail of Probeset Mtr.17054.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.17054.1.S1_at
Species Medicago truncatula
Annotation IMGAG|894.m00020 /FEA=mRNA /DEF=PpiC-type peptidyl-prolyl cis-trans isomerase; Rhodanese-like AC136507.19.201 88807 84400 mth2-24o19 01/13/05
Mapped public sequence ID IMGAG|894.m00020
Gene Ontology GO:0003674 GO:0003755 GO:0006457 GO:0008150
KEGG K01010 K01013
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database TCMT47608  
Target sequence gtgaaagaagatgacccaaaactattggttgatcttcaacagagagtcgctgcaggtgaa
gatt