| Detail of Probeset Mtr.17054.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.17054.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|894.m00020 /FEA=mRNA /DEF=PpiC-type peptidyl-prolyl cis-trans isomerase; Rhodanese-like AC136507.19.201 88807 84400 mth2-24o19 01/13/05 |
| Mapped public sequence ID |
IMGAG|894.m00020 |
| Gene Ontology |
GO:0003674 GO:0003755 GO:0006457 GO:0008150 |
| KEGG |
K01010 K01013 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT47608 |
| Target sequence |
gtgaaagaagatgacccaaaactattggttgatcttcaacagagagtcgctgcaggtgaa
gatt |
