| Detail of Probeset Mtr.17095.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.17095.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|896.m00027 /FEA=mRNA /DEF=ABC transporter related; ABC transporter, transmembrane region, type 1; AAA ATPase AC136840.24.261 98985 100488 mth2-33n3 01/13/05 |
| Mapped public sequence ID |
IMGAG|896.m00027 |
| Gene Ontology |
GO:0005215 GO:0005524 GO:0006810 GO:0016021 GO:0042626 |
| KEGG |
K05658 |
| Transporter |
3.A.1 3.A.1.201 3.A.1.201.1 3.A.1.201.3 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
tattcgttccaatattgcctatggaaaaggtggcaatgcaactgaggcagaaatcattgc
tgctgctgaattggccaatgcagatagattcattagtggcttacagcagggttatgatac
aatagtgggagagagaggaactcaattatcaggtggacagaagcaaagggtagctat |