| Detail of Probeset Mtr.17267.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.17267.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|904.m00003 /FEA=mRNA /DEF=Calcium-binding EF-hand; EPS15 homology (EH); Flagellar calcium-binding protein (calflagin) AC137078.24.21 19999 19502 mth2-10e12 01/13/05 |
| Mapped public sequence ID | IMGAG|904.m00003 |
| Gene Ontology | GO:0000331 GO:0000910 GO:0005509 GO:0005515 GO:0031013 GO:0032781 GO:0043549 GO:0051343 GO:0000003 GO:0009790 GO:0009792 GO:0016477 GO:0040010 GO:0042981 GO:0043277 GO:0051726 |
| KEGG | K02183 |
| Transporter | 2.A.29 2.A.29.23.1 |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40967 TCMS40966 TCMT53442 |
| Target sequence | aaatcctctgtttaccttggtgacatggacgaattgaagacagtcttcacccgctttgac |