| Detail of Probeset Mtr.17316.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.17316.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|904.m00026 /FEA=mRNA /DEF=Generic methyltransferase; SAM (and some other nucleotide) binding motif AC137078.24.251 131624 135826 mth2-10e12 01/13/05 |
| Mapped public sequence ID |
IMGAG|904.m00026 |
| Gene Ontology |
GO:0002119 GO:0005575 GO:0009792 GO:0040007 GO:0040010 GO:0040011 GO:0040017 |
| KEGG |
K00574 K05929 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
atggcaaaaggttagatcacatgatgataggggattccagaagttcttagatagagttga
atacagcgagaagagtattttacgatatgagcgcgtgtatggccatggctttataagcac
cggaggacttgaaacgacaaa |
