Detail of Probeset Mtr.17420.1.S1_x_at in Chip AffyMedicago |
Probeset ID |
Mtr.17420.1.S1_x_at |
Species |
Medicago truncatula |
Annotation |
IMGAG|909.m00023 /FEA=mRNA /DEF=LQGC hypothetical protein AC137552.11.221 119346 119167 mth2-9k5 01/13/05 |
Mapped public sequence ID |
IMGAG|909.m00023 |
Gene Ontology |
GO:0005575 GO:0005634 GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0008233 GO:0032197 |
KEGG |
K07497 |
Transporter |
|
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
N/A |
Target sequence |
atctgctgccgttgatgactatcttcatctaaagctcctacgcttgcgaattcaaagttt
ccaggaaat |