Detail of Probeset Mtr.17483.1.S1_at in Chip AffyMedicago |
Probeset ID |
Mtr.17483.1.S1_at |
Species |
Medicago truncatula |
Annotation |
IMGAG|913.m00004 /FEA=mRNA /DEF=Adenosine kinase; Carbohydrate kinase, PfkB AC137668.18.31 10318 12465 mth2-5f8 01/13/05 |
Mapped public sequence ID |
IMGAG|913.m00004 |
Gene Ontology |
GO:0004001 GO:0005634 GO:0005829 GO:0006166 GO:0006175 GO:0046085 |
KEGG |
K00856 |
Transporter |
|
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
N/A |
Target sequence |
tggatttttcctcactgtatcccccgaatccattcaattagttgctgaacatgcagctgc
gaataacaaggttttcatga |