| Detail of Probeset Mtr.1751.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.1751.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
AW776248 /FEA=mRNA /DEF=homologue to emb|X51598.1|PS16SVAL P.sativum 16S rRNA & tRNA-Val chloroplast genes, partial (16%) |
| Mapped public sequence ID |
AW776248 |
| Gene Ontology |
GO:0003674 GO:0005575 GO:0008150 GO:0005543 GO:0005545 GO:0003978 GO:0005975 GO:0006012 GO:0050662 |
| KEGG |
K00645 K01784 K08051 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
EX525350 TCMS40719
EX522636 AW776248
AW691939 CX527137
AW776956 |
| Target sequence |
gacagaggatgcaagcgttatccggaatgattgttcgtaaagcgtctgtaggtggctttt
taaggtggccggggaatcccagggctcaaccctggacaggtggtgaaaactactaagcta
gagtacgg |