| Detail of Probeset Mtr.1751.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.1751.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | AW776248 /FEA=mRNA /DEF=homologue to emb|X51598.1|PS16SVAL P.sativum 16S rRNA & tRNA-Val chloroplast genes, partial (16%) |
| Mapped public sequence ID | AW776248 |
| Gene Ontology | GO:0003674 GO:0005575 GO:0008150 |
| KEGG | K00627 K00645 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40719 AW776248 BG644545 AW776956 AW736514 |
| Target sequence | cgtagagatcggaaggaacaccaatggcgaaagcactctgctgggccgacactgacactg |