Detail of Probeset Mtr.17540.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.17540.1.S1_at
Species Medicago truncatula
Annotation IMGAG|1003.m00001 /FEA=mRNA /DEF=LQGC hypothetical protein AC141322.24.11 7179 6199 mth2-8e1 01/13/05
Mapped public sequence ID IMGAG|1003.m00001
Gene Ontology GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0005739 GO:0008233 GO:0032197
KEGG K15001
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence tagtttgccggaacgccgtgctggaaaattgtacggcggatactagaaggaaaaccatgc
ctgttaatagggaaatgctaaccggtgcctccgggacactgattaaggata