| Detail of Probeset Mtr.17605.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.17605.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|918.m00005 /FEA=mRNA /DEF=Regulator of chromosome condensation, RCC1; Regulator of chromosome condensation/beta-lactamase-inhibitor protein II AC137823.43.51 31376 30930 mth2-14c17 01/13/05 |
| Mapped public sequence ID |
IMGAG|918.m00005 |
| Gene Ontology |
GO:0004842 GO:0005743 GO:0007283 |
| KEGG |
K01824 K10615 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
tgggccagctgggacatacttcacttcagtatggggataaagagttaattccaaggaggg
tggtttccctcgatagtattttcataaaagacgcagcatgcggtggtgtacatacatgtg
ctttaactcaggaaggagcacttt |