Detail of Probeset Mtr.17620.1.S1_at in Chip AffyMedicago |
Probeset ID |
Mtr.17620.1.S1_at |
Species |
Medicago truncatula |
Annotation |
IMGAG|918.m00020 /FEA=mRNA /DEF=LQGC hypothetical protein AC137823.43.201 78953 78774 mth2-14c17 01/13/05 |
Mapped public sequence ID |
IMGAG|918.m00020 |
Gene Ontology |
GO:0003674 GO:0005575 GO:0005737 GO:0005887 GO:0005938 GO:0006810 GO:0006952 GO:0009734 GO:0016788 GO:0019863 GO:0005634 GO:0005515 GO:0006457 GO:0009408 GO:0030544 |
KEGG |
K03686 K05516 K07497 |
Transporter |
2.A.7 2.A.7.4 3.A.5 2.A.7.4.1 2.A.7.4.2 3.A.5.8.1 |
Transcription Factor |
C2H2 |
Mapped unigene in the TRICHOME database |
N/A |
Target sequence |
ttttgaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataa |