| Detail of Probeset Mtr.1772.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.1772.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
AW980815 /FEA=mRNA /DEF=similar to UP|METM_ACTCH (P50303) S-adenosylmethionine synthetase 3 (Methionine adenosyltransferase 3) (AdoMet synthetase 3) (Fragment) , partial (6%) |
| Mapped public sequence ID |
AW980815 |
| Gene Ontology |
GO:0005634 GO:0005730 GO:0005819 GO:0006368 GO:0008023 GO:0016072 GO:0016944 |
| KEGG |
K25054 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
AW980815 TCMT52965
|
| Target sequence |
gcaacatgcatcaaggccagaagccacacctttggattttgtgatccggccccaatctaa
aattgaccaccttgatgagaaaaccatcttccacttgaacccttcaagaccagtcttgtt
tgaagatgaataagaaattgcagcagttg |