| Detail of Probeset Mtr.17787.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.17787.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|1015.m00001 /FEA=mRNA /DEF=Isopenicillin N synthase; 2OG-Fe(II) oxygenase AC142498.21.11 7699 4521 mth2-24a18 01/13/05 |
| Mapped public sequence ID | IMGAG|1015.m00001 |
| Gene Ontology | GO:0008152 GO:0016491 |
| KEGG | K05277 K05278 K05933 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT49569 |
| Target sequence | ggctttgtcattaaaccttggattagaagaaaaaattcttcaaaatgcatttgggggtga |