| Detail of Probeset Mtr.17885.1.S1_x_at in Chip AffyMedicago |
| Probeset ID |
Mtr.17885.1.S1_x_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|927.m00013 /FEA=mRNA /DEF=hypothetical protein AC137996.33.121 51354 52034 mth2-19k16 01/13/05 |
| Mapped public sequence ID |
IMGAG|927.m00013 |
| Gene Ontology |
GO:0000003 GO:0002009 GO:0008406 GO:0009792 GO:0040011 GO:0040025 GO:0040035 GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0008233 GO:0032197 GO:0003674 GO:0003774 GO:0005575 GO:0007626 GO:0008150 GO:0031672 GO:0003677 GO:0004386 GO:0005524 GO:0005634 GO:0005654 GO:0006357 GO:0004024 GO:0006066 GO:0006113 |
| KEGG |
K00001 K00140 K00540 K03243 K03260 K08300 K11135 K11647 K13663 K15001 K22300 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
tccttcaccggcacagagattagatcaaatgtcatgggtattcctgtaaccataaatgag
cagattattgctcaagccatgggaagggatacttctggcaaatactttggagaagaaatt
cctaatccaagaaccagctcttggaaggaaattgtcaatgagaccatctatgggtctaag
gttgctcaaccttacagcactttgagcattgagaagaaaatgctgctgaagatccagaat
gaaaacatctttccc |