| Detail of Probeset Mtr.17905.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.17905.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|928.m00002 /FEA=mRNA /DEF=von Willebrand factor, type A; Ubiquitin interacting motif AC138010.12.11 14016 8430 mth2-21i21 01/13/05 |
| Mapped public sequence ID |
IMGAG|928.m00002 |
| Gene Ontology |
GO:0000502 GO:0003674 GO:0005515 GO:0005575 GO:0008150 GO:0031145 GO:0051436 GO:0051437 |
| KEGG |
K03029 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
gcagagaataagacaactgatttgatggatgatgagaatgccctactgcagcaggcgctt
gcaatgtcaatggatgaccctgcggttggccatgatgtaagagatacagatatgtcagaa
gcatctacagatgaccctgagctggcactagctctccaattgtc |
