| Detail of Probeset Mtr.17917.1.S1_x_at in Chip AffyMedicago |
| Probeset ID |
Mtr.17917.1.S1_x_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|928.m00018 /FEA=mRNA /DEF=hypothetical protein AC138010.12.171 90595 90777 mth2-21i21 01/13/05 |
| Mapped public sequence ID |
IMGAG|928.m00018 |
| Gene Ontology |
GO:0003674 GO:0003697 GO:0003723 GO:0005737 GO:0007242 GO:0000943 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0008233 GO:0032197 GO:0007288 GO:0005739 |
| KEGG |
K00140 K13663 K15001 K17671 K22300 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
atgagagctcagaagcaaccctgctcagaagcaaccctgttcagaagcaaccttgctcag
aagcaaccctgctcagaagcaaccctgttcagaagcaaccttgctcagaagcaaccctgt
tcagaagcaaccttgctcagaagcaaccctgctcagaagcaaccctgt |
