| Detail of Probeset Mtr.17941.1.S1_x_at in Chip AffyMedicago |
| Probeset ID |
Mtr.17941.1.S1_x_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1020.m00016 /FEA=mRNA /DEF=hypothetical protein AC143340.4.161 108529 107646 mth2-7f4 01/13/05 |
| Mapped public sequence ID |
IMGAG|1020.m00016 |
| Gene Ontology |
GO:0005215 GO:0005515 GO:0005524 GO:0005624 GO:0006810 GO:0009986 GO:0016021 GO:0042493 GO:0046581 GO:0005543 GO:0005548 GO:0005768 GO:0005794 GO:0005886 GO:0005887 GO:0008203 GO:0009720 GO:0010033 GO:0015485 GO:0017127 GO:0019534 GO:0030301 GO:0032367 GO:0033344 GO:0033700 GO:0034041 GO:0034436 GO:0034437 GO:0042632 GO:0042803 GO:0042987 GO:0043531 GO:0043691 GO:0045449 GO:0045542 GO:0046982 GO:0055091 |
| KEGG |
K05658 K05679 K05681 |
| Transporter |
3.A.1 3.A.1.201 3.A.1.204 3.A.1.201.1 3.A.1.201.3 3.A.1.204.2 3.A.1.204.3 |
| Transcription Factor |
HB |
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
atgatccaggcccagtctgtattgggttttgcttggcaaagg |