| Detail of Probeset Mtr.18022.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.18022.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|936.m00014 /FEA=mRNA /DEF=Eukaryotic protein of unknown function DUF284 AC138130.9.131 71946 68510 mth2-31d24 01/13/05 |
| Mapped public sequence ID | IMGAG|936.m00014 |
| Gene Ontology | GO:0003674 GO:0008150 |
| KEGG | K16183 |
| Transporter | 9.A.1 9.A.1.1.1 |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT58568 |
| Target sequence | tgcaaacagaccactgtgatccagtagacaaaacagaaggaaaggagccaattgttcctt |