Detail of Probeset Mtr.18058.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.18058.1.S1_at
Species Medicago truncatula
Annotation IMGAG|1021.m00018 /FEA=mRNA /DEF=Putative DNA helicase; DEAD/DEAH box helicase, N-terminal; AAA ATPase AC143341.8.171 87686 94638 mth2-7a11 01/13/05
Mapped public sequence ID IMGAG|1021.m00018
Gene Ontology GO:0000122 GO:0003677 GO:0003702 GO:0005515 GO:0005634 GO:0005737 GO:0030424 GO:0043025
KEGG K01529
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence atcatggattggtcttctaaagagctttacaacagtaaggtcaaggctcatgcatgtgtt
gcttcacatatgctatatgatcttgagggcgtgaagaagacatcttcaactgaaccaacc
cttcttctcatagacacagctggatgtgatatggaagaga