| Detail of Probeset Mtr.18058.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.18058.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1021.m00018 /FEA=mRNA /DEF=Putative DNA helicase; DEAD/DEAH box helicase, N-terminal; AAA ATPase AC143341.8.171 87686 94638 mth2-7a11 01/13/05 |
| Mapped public sequence ID |
IMGAG|1021.m00018 |
| Gene Ontology |
GO:0000122 GO:0003677 GO:0003702 GO:0005515 GO:0005634 GO:0005737 GO:0030424 GO:0043025 |
| KEGG |
K01529 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
atcatggattggtcttctaaagagctttacaacagtaaggtcaaggctcatgcatgtgtt
gcttcacatatgctatatgatcttgagggcgtgaagaagacatcttcaactgaaccaacc
cttcttctcatagacacagctggatgtgatatggaagaga |