Detail of Probeset Mtr.18175.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.18175.1.S1_at
Species Medicago truncatula
Annotation IMGAG|1025.m00009 /FEA=mRNA /DEF=Peptidase M10A and M12B, matrixin and adamalysin AC144345.18.81 44290 43895 mth2-25i7 01/13/05
Mapped public sequence ID IMGAG|1025.m00009
Gene Ontology GO:0001503 GO:0001666 GO:0001968 GO:0004222 GO:0005509 GO:0005515 GO:0005583 GO:0005615 GO:0005764 GO:0005794 GO:0006508 GO:0008233 GO:0008270 GO:0009612 GO:0030282 GO:0030574 GO:0031623 GO:0035116 GO:0043171 GO:0043627 GO:0046581 GO:0048306 GO:0050750 GO:0051216
KEGG K01417 K07761
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence ttgtggtgggtgacacggttatcaaactcggttcaaatgtgaattcaggtttcatacgcc
tgattgcttcaaagtactgggtgttgccaactgacaactacatgtggtcatggcag