| Detail of Probeset Mtr.18186.1.S1_a_at in Chip AffyMedicago | |
| Probeset ID | Mtr.18186.1.S1_a_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|1025.m00017 /FEA=mRNA /DEF=Peptidase M10A and M12B, matrixin and adamalysin; Peptidoglycan binding-like; Peptidase, metallopeptidases AC144345.18.161 70471 69452 mth2-25i7 01/13/05 |
| Mapped public sequence ID | IMGAG|1025.m00017 |
| Gene Ontology | GO:0004222 GO:0005578 GO:0006508 |
| KEGG | K01417 K07761 K07763 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | cctaagggcacaaaaaagctgacatatggttttcttccagggaaa |