| Detail of Probeset Mtr.18286.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.18286.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|947.m00003 /FEA=mRNA /DEF=Protein prenyltransferase; Pentatricopeptide repeat AC138580.19.21 5556 7229 mth2-14e15 01/13/05 |
| Mapped public sequence ID |
IMGAG|947.m00003 |
| Gene Ontology |
GO:0003674 GO:0005515 GO:0005737 GO:0008150 |
| KEGG |
K14571 K19803 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
tggggaaaatctcttgtgtgttgaagctagtcgat |