| Detail of Probeset Mtr.18309.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.18309.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|947.m00024 /FEA=mRNA /DEF=Major intrinsic protein AC138580.19.231 108294 110095 mth2-14e15 01/13/05 |
| Mapped public sequence ID |
IMGAG|947.m00024 |
| Gene Ontology |
GO:0005515 GO:0005887 GO:0005902 GO:0006833 GO:0015250 GO:0015288 GO:0016020 GO:0016323 GO:0051260 |
| KEGG |
K09873 |
| Transporter |
1.A.8 1.A.8.10.1 1.A.8.10.2 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT43924 |
| Target sequence |
atgcatgaaccctgcacttgcttttggcccttctttggtgggatggagatggcactacca
ctggatcttctgggttggtccattcatcggtgcagcattggcagcactcatatatgaata
tcttgtgatcccaactgagccacctca |