| Detail of Probeset Mtr.18338.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.18338.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1029.m00017 /FEA=mRNA /DEF=LQGC hypothetical protein AC144459.8.161 50018 50197 mth2-23o13 01/13/05 |
| Mapped public sequence ID |
IMGAG|1029.m00017 |
| Gene Ontology |
GO:0005575 GO:0005634 GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0008233 GO:0032197 GO:0000077 GO:0000723 GO:0001701 GO:0001832 GO:0003684 GO:0005657 GO:0006302 GO:0007095 GO:0008134 GO:0008283 GO:0030870 GO:0031575 GO:0042405 GO:0045190 GO:0047485 GO:0048145 GO:0050885 |
| KEGG |
K07497 K10867 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
atggctgctatctttgatctaacggtcactgtgcttcctgcattttacactatcttttgt
gctttttttttggacccttggatctttgatccagtggctgtgatgtg |