| Detail of Probeset Mtr.18630.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.18630.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1041.m00019 /FEA=mRNA /DEF=Prenyltransferase/squalene oxidase; Terpene synthase; Terpenoid cylases/protein prenyltransferase alpha-alpha toroid AC144538.22.181 100418 106936 mth2-31l21 01/13/05 |
| Mapped public sequence ID |
IMGAG|1041.m00019 |
| Gene Ontology |
GO:0003674 GO:0005575 GO:0008150 GO:0019745 GO:0042300 GO:0042561 |
| KEGG |
K01853 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT40960 BQ144826
|
| Target sequence |
tcccagttggaagaaggcgattggccccaacaggaaatcacaggagtattcatgaaaaat
tgtatgttgcattacccaatgtatagagatatttaccccttgtgggctctagccgag |
