| Detail of Probeset Mtr.18783.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.18783.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|963.m00007 /FEA=mRNA /DEF=Terpenoid synthase; Terpenoid cylases/protein prenyltransferase alpha-alpha toroid; Terpene synthase, metal-binding AC139853.17.71 25141 26791 mth2-13d20 01/13/05 |
| Mapped public sequence ID | IMGAG|963.m00007 |
| Gene Ontology | |
| KEGG | K04121 K07384 K07385 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | ggctcgttggttgaattctagtcatttgccaagggcagaggatta |