Detail of Probeset Mtr.18892.1.S1_s_at in Chip AffyMedicago
Probeset ID Mtr.18892.1.S1_s_at
Species Medicago truncatula
Annotation IMGAG|1055.m00001 /FEA=mRNA /DEF=Peptidase aspartic; Peptidase aspartic, active site AC144656.12.11 2402 1182 mth2-27d4 01/13/05
Mapped public sequence ID IMGAG|1055.m00001
Gene Ontology GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0008233 GO:0032197
KEGG K07497
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence aggtgtctccacaggaactttccatagtgctgggttt