| Detail of Probeset Mtr.18893.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.18893.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|1055.m00002 /FEA=mRNA /DEF=gag/pol polyprotein AC144656.12.21 4430 2475 mth2-27d4 01/13/05 |
| Mapped public sequence ID | IMGAG|1055.m00002 |
| Gene Ontology | GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0008233 GO:0032197 |
| KEGG | K07497 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | gcctctctgtttaaccacgatcataccaattgcccagaatgc |