| Detail of Probeset Mtr.18963.1.S1_x_at in Chip AffyMedicago | |
| Probeset ID | Mtr.18963.1.S1_x_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|1059.m00010 /FEA=mRNA /DEF=hypothetical protein AC144724.8.101 31425 31622 mth2-7g10 01/13/05 |
| Mapped public sequence ID | IMGAG|1059.m00010 |
| Gene Ontology | GO:0003674 GO:0003697 GO:0003723 GO:0005737 GO:0007242 GO:0000943 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0008233 GO:0032197 GO:0007288 GO:0005739 |
| KEGG | K00140 K13663 K15001 K17671 K22300 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | atgagagctcagaagcaaccctgttcagaagcaaccttgctcagaagcaaccctgttcag |