| Detail of Probeset Mtr.19056.1.S1_x_at in Chip AffyMedicago |
| Probeset ID |
Mtr.19056.1.S1_x_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1062.m00003 /FEA=mRNA /DEF=BV-16/1-related AC144727.11.21 2499 2754 mth2-8n1 01/13/05 |
| Mapped public sequence ID |
IMGAG|1062.m00003 |
| Gene Ontology |
GO:0002119 GO:0009792 GO:0015992 GO:0016021 GO:0018996 GO:0040007 GO:0040010 GO:0040011 GO:0040035 |
| KEGG |
K02155 |
| Transporter |
3.A.2 3.A.2.2.3 9.B.16.1.1 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
atggctccattcatcggtgacgaaactgctccttttttcggcttcctcggtgccgccgcg
acacttgttttctcatgtatgggagtggcatgcggaacaacgaagagtggtgtaggagca
gcatcaatgggagtgatcagggttgttcctacgaatctggagggtcggctctgtaag |