| Detail of Probeset Mtr.19160.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.19160.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1069.m00017 /FEA=mRNA /DEF=Major facilitator superfamily; Sugar transporter; General substrate transporter; Major facilitator superfamily MFS_1; Sugar transporter superfamily AC144806.10.161 112295 119175 mth2-34h22 01/13/05 |
| Mapped public sequence ID |
IMGAG|1069.m00017 |
| Gene Ontology |
GO:0005351 GO:0008643 GO:0015519 GO:0015753 GO:0016021 |
| KEGG |
K06609 K08070 K08139 |
| Transporter |
2.A.1 2.A.1.1 2.A.1.1.1 2.A.1.1.26 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
tcttgtttcaacagatcacgggccaaccaagtgttctctactacgctgcatcaatcctac
agagtgcaggat |