| Detail of Probeset Mtr.19206.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.19206.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|977.m00014 /FEA=mRNA /DEF=Ras GTPase; Sigma-54 factor, interaction region; Small GTP-binding protein domain; ADP-ribosylation factor; Ras small GTPase, Ras type; Ras small GTPase, Rab type; Ras small GTPase, Rho type; GTP-binding nuclear protein Ran |
| Mapped public sequence ID |
IMGAG|977.m00014 |
| Gene Ontology |
GO:0003924 GO:0006928 GO:0016023 |
| KEGG |
K07976 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT59885 |
| Target sequence |
tatttcatggaaacttctgcactagagtcattgaatgtggacaatgctttcgtcgaagtg
ctcactcagatatacaatgtagtgagtaagaagactcttgagaaagagaatggctctgca
tcagtgcctaagggagagactatcaatattggtaaagatgatgtttcagatgttaagaag
agtggatgctgcagtacagcata |
