Detail of Probeset Mtr.19265.1.S1_s_at in Chip AffyMedicago |
Probeset ID |
Mtr.19265.1.S1_s_at |
Species |
Medicago truncatula |
Annotation |
IMGAG|1076.m00014 /FEA=mRNA /DEF=hypothetical protein AC145222.18.141 43798 43443 mth2-29a15 01/13/05 |
Mapped public sequence ID |
IMGAG|1076.m00014 |
Gene Ontology |
GO:0004301 GO:0005625 GO:0005829 GO:0006800 GO:0006805 GO:0006874 GO:0006954 GO:0009636 GO:0017144 GO:0019439 GO:0042803 GO:0045909 |
KEGG |
K08726 |
Transporter |
|
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
ES612410 |
Target sequence |
gtcttcaagcgtctcttttgggcctttcgtccgtgcatctcaggtttcgaattctgcaaa
ccaattgtccaaattgacgcaacttggttgtatg |