Detail of Probeset Mtr.19265.1.S1_s_at in Chip AffyMedicago
Probeset ID Mtr.19265.1.S1_s_at
Species Medicago truncatula
Annotation IMGAG|1076.m00014 /FEA=mRNA /DEF=hypothetical protein AC145222.18.141 43798 43443 mth2-29a15 01/13/05
Mapped public sequence ID IMGAG|1076.m00014
Gene Ontology GO:0004301 GO:0005625 GO:0005829 GO:0006800 GO:0006805 GO:0006874 GO:0006954 GO:0009636 GO:0017144 GO:0019439 GO:0042803 GO:0045909
KEGG K08726
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database ES612410  
Target sequence gtcttcaagcgtctcttttgggcctttcgtccgtgcatctcaggtttcgaattctgcaaa
ccaattgtccaaattgacgcaacttggttgtatg