| Detail of Probeset Mtr.19384.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.19384.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|981.m00017 /FEA=mRNA /DEF=Small GTP-binding protein domain; Ras GTPase; ADP-ribosylation factor; Ras small GTPase, Ras type; Ras small GTPase, Rab type; Ras small GTPase, Rho type; GTP-binding nuclear protein Ran AC140549.11.171 73041 72000 mth2-28 |
| Mapped public sequence ID |
IMGAG|981.m00017 |
| Gene Ontology |
GO:0003924 GO:0005794 GO:0006886 GO:0006888 GO:0016192 |
| KEGG |
K07976 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT43575 TCMT43576
|
| Target sequence |
aaggcatttgcggatgagcttggtatccctttccttgagacaagtgctaaagactccatc
aatgtcgagcaggctttcttaactatggcagctgagattaagaacaagatgggaagtcaa
ccaactggtagtaagtcagcagcagaatctgttcagatgaaggggcagccaatccaacag
aacacca |