| Detail of Probeset Mtr.19456.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.19456.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1178.m00016 /FEA=mRNA /DEF=AAA ATPase, central region AC147498.14.151 61265 62827 mth2-6f18 01/13/05 |
| Mapped public sequence ID |
IMGAG|1178.m00016 |
| Gene Ontology |
GO:0002119 GO:0005743 GO:0006461 GO:0009792 GO:0016887 GO:0040007 GO:0040010 GO:0005739 GO:0016226 GO:0042623 |
| KEGG |
K08900 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
CX532386 |
| Target sequence |
tttgatgccaaagtcgaccaccgaagatgctgagtcttgcttgaagaatttgattcaata
tcttgaaattgcaaaggaaaaggaagaggaggaagcaaagaaaaacggtgagaaagctca
actggtggcagggaaagataaacaagaattggc |
