Detail of Probeset Mtr.19518.1.S1_s_at in Chip AffyMedicago |
Probeset ID |
Mtr.19518.1.S1_s_at |
Species |
Medicago truncatula |
Annotation |
IMGAG|1182.m00008 /FEA=mRNA /DEF=Helix-turn-helix motif; Lambda repressor-like, DNA-binding AC147741.9.71 36912 37079 mth2-17b23 01/13/05 |
Mapped public sequence ID |
IMGAG|1182.m00008 |
Gene Ontology |
GO:0003700 GO:0003713 GO:0004402 GO:0005622 GO:0005634 GO:0005669 GO:0005737 GO:0006355 GO:0007275 GO:0008168 GO:0019216 GO:0043388 GO:0045446 |
KEGG |
K03627 |
Transporter |
|
Transcription Factor |
MBF1 |
Mapped unigene in the TRICHOME database |
TCMS41114 TCMT50045
|
Target sequence |
aagaagcttactcaggcacaacttgctcaaattatca |