Detail of Probeset Mtr.19600.1.S1_s_at in Chip AffyMedicago |
Probeset ID |
Mtr.19600.1.S1_s_at |
Species |
Medicago truncatula |
Annotation |
IMGAG|1187.m00012 /FEA=mRNA /DEF=hypothetical protein AC147963.2.121 47131 47991 mth2-42e19 01/13/05 |
Mapped public sequence ID |
IMGAG|1187.m00012 |
Gene Ontology |
GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0008233 GO:0032197 |
KEGG |
K07497 |
Transporter |
|
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
N/A |
Target sequence |
attctttagaaatgaagctctctcgaaaccatctttttactatgatatccaagttgatgc
tgcagaagacatagctagcattttttgggcagatg |