| Detail of Probeset Mtr.19815.1.S1_x_at in Chip AffyMedicago |
| Probeset ID |
Mtr.19815.1.S1_x_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1195.m00016 /FEA=mRNA /DEF=hypothetical protein AC148238.4.151 78729 78911 mth2-4a11 01/13/05 |
| Mapped public sequence ID |
IMGAG|1195.m00016 |
| Gene Ontology |
GO:0005515 GO:0000055 GO:0000079 GO:0003674 GO:0005634 GO:0005635 GO:0005737 GO:0005783 GO:0006611 GO:0003735 GO:0042254 GO:0006412 |
| KEGG |
K00924 K02874 K14201 |
| Transporter |
1.A.26 1.A.26.1.1 |
| Transcription Factor |
WRKY |
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
tacgctgatgcgcagttatgccaggaggaggtcatgagcatgacccctcagcagtggttt
gaggccatgacccatatgagggagcagatcgcgccgattttgaccaggaggagagcccag
aggccgaggaggaggcaccatcatcaggatcaggaccagtag |