Detail of Probeset Mtr.19903.1.S1_s_at in Chip AffyMedicago
Probeset ID Mtr.19903.1.S1_s_at
Species Medicago truncatula
Annotation IMGAG|1198.m00034 /FEA=mRNA /DEF=putative reverse transcriptase-related AC148242.14.341 67613 68377 mth2-18f6 01/13/05
Mapped public sequence ID IMGAG|1198.m00034
Gene Ontology GO:0003674 GO:0005515 GO:0005575 GO:0005737 GO:0005829 GO:0006414 GO:0008150
KEGG K02918
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence ttctatcagacaacagtcagaccgacaatgttgtatgg